Mutagenic activity of nine N,N-disubstituted hydrazines in the Salmonella/mammalian microsome assay.

The mutagenic activity of N,N-dimethyl-, N,N-diethyl-, N,N-dibutyl-, N,N-diisobutyl-, N,N-di(p-tolyl)-, N-ethyl-N-phenyl-, N,N-dibenzyl-, N,N-diphenyl- and N,N-diisopropylhydrazine was examined in the Salmonella/mammalian microsome assay using the strains TA1535, TA1537, TA97, TA98, TA100, TA102 and TA1530. All nine hydrazines were mutagenic in at least one tester strain, although of borderline significance for some of the compounds. The mutagenic potencies of the hydrazines varied 2-3 orders of magnitude, from very weak to moderate mutagenic activity. In general, the addition of S9 resulted in a lowering of the mutagenic activity and a lowering of the toxic properties of the hydrazines. The test results were relatively difficult to evaluate due to toxic effects of many of the test compounds on the test bacteria which may have resulted in an underestimation of the mutagenic potencies of some of the compounds. The pattern of mutagenic activity of the hydrazines in the different tester strains indicates that more than one mechanism of action may be involved in the mutagenicity.     

Membrane-trafficking RabA4c involved in the effect of glycine betaine on recovery from chilling stress in Arabidopsis

Glycine betaine (GB) can confer tolerance to several types of stress at low concentrations, either after application to plants or in transgenics engineered to overproduce GB. Based on earlier studies on levels of GB in plants and evidence for effects on gene expression, we hypothesized that at least part of this effect could be ascribed to the activation of the expression of stress tolerance genes. Using a strategy based on high-throughput gene expression analysis with microarrays followed by confirmation with northern blots, we identified Arabidopsis genes upregulated in roots that reinforce intracellular processes protecting cells from oxidative damage and others that appear to be involved in reinforcing a scavenging system for reactive oxygen species (ROS) in cell walls. Upregulated genes in roots include those for the membrane-trafficking RabA4c, the root-specific NADPH-dependent ferric reductase (FRO2) localized to the plasma membrane, mitochondrial catalase 2 and the cell wall peroxidase ATP3a. Comparative studies with wild-type Arabidopsis and knockout mutants for the membrane-trafficking RabA4c gene demonstrated that the mutants respond only slightly to GB, if at all, compared with wild-type in relation to root growth recovery after chilling stress, demonstrating the role of RabA4c in relation to the GB effect. The results point toward links between oxidative stress, gene expression, membrane trafficking and scavenging of ROS such as superoxide and hydrogen peroxide in relation to GB effects on chilling tolerance in plants.     

Location of crosslinks in chemically stabilized horseradish peroxidase: implications for design of crosslinks.

The bifunctional compound, ethylene-glycol bis(N-hydroxysuccinimidylsuccinate) (EGNHS), stabilizes horseradish peroxidase C (HRP) by reaction with the enzyme's lysine residues. In this study we compare native and modified HRP by proteolytic fragmentation, peptide sequencing, and mass spectroscopy, and identify the sites of modification. Most significantly, EGNHS is shown to form a crosslink between Lys232 and Lys241 of HRP and modifies Lys174 without formation of a crosslink. These findings are in agreement with the lysine side-chain reactivities predicted from the surface accessibility of the amino groups, and the maximal span of 16 A of the EGNHS crosslinker.     

Stressful life events preceding the acute onset of schizophrenia: A cross-national study from the World Health Organization

This study reports on the findings from a WHO sponsored cross-national investigation of life events and schizophrenia. Data are presented from a series of 386 acutely ill schizophrenic patients selected from nine field research centers located in developing and developed countries (Aarhus, Denmark; Agra, India; Cali, Colombia; Chandigarh, India; Honolulu, USA; Ibadan, Nigeria; Nagasaki, Japan; Prague, Czechoslovakia; Rochester, USA). On a methodological level, the study demonstrates that life event methodologies originating in the developed countries can be adapted for international studies and may be used to collect reasonably reliable and comparable cross-cultural data on psychosocial factors affecting the course of schizophrenic disorders. Substantive findings replicate the results of prior studies which conclude that socioenvironmental stressors may precipitate schizophrenic attacks and such events tend to cluster in the two to three week period immediately preceding illness onset.The paper was prepared by these authors on behalf of the collaborating investigators listed on page 196.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Effect of dietary boron on mineral, estrogen, and testosterone metabolism in postmenopausal women

A study was done to examine the effects of aluminum, magnesium, and boron on major mineral metabolism in postmenopausal women. This communication describes some of the effects of dietary boron on 12 women between the ages of 48 and 82 housed in a metabolic unit. A boron supplement of 3 mg/day markedly affected several indices of mineral metabolism of seven women consuming a low-magnesium diet and five women consuming a diet adequate in magnesium; the women had consumed a conventional diet supplying about 0.25 mg boron/day for 119 days. Boron supplementation markedly reduced the urinary excretion of calcium and magnesium; the depression seemed more marked when dietary magnesium was low. Boron supplementation depressed the urinary excretion of phosphorus by the low-magnesium, but not by the adequate-magnesium, women. Boron supplementation markedly elevated the serum concentrations of 17 beta-estradiol and testosterone; the elevation seemed more marked when dietary magnesium was low. Neither high dietary aluminum (1000 mg/day) nor an interaction between boron and aluminum affected the variables presented. The findings suggest that supplementation of a low-boron diet with an amount of boron commonly found in diets high in fruits and vegetables induces changes in postmenopausal women consistent with the prevention of calcium loss and bone demineralization.